CpG oligodeoxynucleotides Mouse

Novus Biologicals, part of Bio-Techne | Catalog # NBP2-26235

Catalog #
Availability
Size / Price
Qty
NBP2-26235
Print Quote
Bulk Order
100% Guarantee

Key Product Details

Species

Mouse

Applications

Functional Assay

Product Summary for CpG oligodeoxynucleotides Mouse

Mouse Sequence CpG ODN (1826) Type B: 5' T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T 3

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TCCATGAGCTTCCTGAGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Product Specifications

Specificity

CpG ODN (1826) with negative control oligo, TLR9 ligand (mouse)

Applications

Ligand Activation (5-20 ug/ml)

Application Notes

A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Scientific Data Images for CpG oligodeoxynucleotides Mouse

CpG oligodeoxynucleotides Mouse [NBP2-26235] - CpG oligodeoxynucleotides Mouse Evaluation of the mCpG ODN 1826 ligand activity on NF-kB SEAPorter RAW cell line. Cell line is a stably transfected RAW 264.7 cell line that expresses the secreted alkaline phosphatase (SEAP) reporter gene under the transcriptional control of an NF-kB response element. RAW 264.7 cells endogenously express Toll-like receptor 9 (TLR9). Cells were plated in 96-well plates at 0.85 x 10^5 cells/well. After 16 h, cells were stimulated with various amounts of mCpG ODN 1826 for 24 h. SEAP was analyzed using the SEAPorter Assay Kit. Data Summary: mCpG ODN 1826 specifically activated the TLR9-depedent NF-kB/SEAP reporter cells in a dose dependent manner.

Formulation, Preparation, and Storage

Formulation

Sterile water

Concentration

Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Shipping

The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.

Storage

Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.

Background: CpG oligodeoxynucleotides Mouse

Synthetic oligodeoxynucleotides (ODN) containing unmethylated deoxycytosine-deoxyguanosine (CpG) motifs. These CpG motifs are present at a 20 fold greater frequency in bacterial DNA than mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9). Two types of CpG ODNs have been identified based on their distinct activity on plasmacytoid dendritic cells (pDC), which is the key sensors of the CpG motifs. CpG Type A induces IFN-a production in pDC whereas Type B strongly activates B cells and weakly activates IFN-a stimulation. The CpG ODN sequence differs between human and mouse, however both negative controls contain GpC instead of CpG.

Alternate Names

CpG oligodeoxynucleotides (ODN), ODN

Additional CpG oligodeoxynucleotides Mouse Products

Product Documents for CpG oligodeoxynucleotides Mouse

Product Datasheets

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot number in the search box below.

Product Specific Notices for CpG oligodeoxynucleotides Mouse

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Privacy Policy
Cookie Policy
Site Map
© Copyright 2026 Bio-Techne. All Rights Reserved. All trademarks and registered trademarks are the property of Bio-Techne and its brands unless otherwise specified.