CpG oligodeoxynucleotides with negative control, TLR9 ligand

Novus Biologicals, part of Bio-Techne | Catalog # NBP2-26232

Novus Biologicals, part of Bio-Techne
Catalog #
Availability
Size / Price
Qty
NBP2-26232
Print Quote
Bulk Order
100% Guarantee

Key Product Details

Species

Human

Applications

Functional Assay

Product Summary for CpG oligodeoxynucleotides with negative control, TLR9 ligand

Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Product Specifications

Specificity

CpG ODN (2006) with negative control oligo, TLR9 ligand (human)

Applications

Ligand Activation (5 - 20 ug/ml)

Application Notes

A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Scientific Data Images for CpG oligodeoxynucleotides with negative control, TLR9 ligand

CpG oligodeoxynucleotides with negative control, TLR9 ligand [NBP2-26232] - Validation of CpG using the TLR9/HEK 293 cell line. The assay was performed using the NF-kB SEAPorter Assay Kit. The Vector/HEK 293 and TLR9/HEK 293 cell lines were transfected with NF-kB/SEAP reporter plasmid for 16 h. Cells were stimulated with various amounts of CpG for 24 h followed by SEAP assay.

Kit Contents for CpG oligodeoxynucleotides with negative control, TLR9 ligand

Formulation, Preparation, and Storage

Formulation

Sterile water

Concentration

Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Shipping

The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below.

Storage

Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.

Background: CpG oligodeoxynucleotides with negative control, TLR9 ligand

Synthetic oligodeoxynucleotides (ODN) containing unmethylated deoxycytosine-deoxyguanosine (CpG) motifs. These CpG motifs are present at a 20 fold greater frequency in bacterial DNA than mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9). Two types of CpG ODNs have been identified based on their distinct activity on plasmacytoid dendritic cells (pDC), which are the key sensors of the CpG motifs. CpG Type A induces IFN-a production in pDC whereas Type B promotes survival, activation and maturation of pDC. The CpG ODN sequence differs between human and mouse, however both negative controls contain GpC instead of CpG.

Alternate Names

CpG oligodeoxynucleotides, CpG oligodeoxynucleotides with negative control oligo, TLR9 ligand (human)

Additional CpG oligodeoxynucleotides with negative control, TLR9 ligand Products

Product Documents for CpG oligodeoxynucleotides with negative control, TLR9 ligand

Product Datasheets

Certificate of Analysis

To download a Certificate of Analysis, please enter a lot number in the search box below.

Product Specific Notices for CpG oligodeoxynucleotides with negative control, TLR9 ligand

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Privacy and Cookie Policy
Site Map
© Copyright 2026 Bio-Techne. All Rights Reserved. All trademarks and registered trademarks are the property of Bio-Techne and its brands unless otherwise specified.